IAB Logo
Molecular Microbial Ecology Lab
205 West Ridge Research Building
University of Alaska Fairbanks

(907) 474-7957

- -


About the Lab

Projects

Publications

Photo Gallery




NEW PUBLICATION!!

Taylor DL & McCormick MK. 2008. Internal transcribed spacer primers and sequences for improved characterization of basidiomycetous orchid mycorrhizas. New Phytologist 177: 1020–1033. Supplemental Material - Figures s1-s4. Supplemental Material - Table s1.

Molecular Methods for Orchid Fungi

This page has information on a variety of PCR primers we have developed for the amplification of fungi from orchid mycorrhizae.  Note that their levels of selectivity for various fungal clades differs.  However, all have been designed and shown to minimize amplification of plant sequences.  Most primer pairs are designed for amplification of the nuclear ribosomal ITS region, which is highly variable across fungal species and yet fairly conserved within fungal species.  This region is the gold-standard for species identification in fungi.  However, it is not suited to phylogenetic analysis at deeper time scales, i.e. comparisons among Orders or Families. 

BEFORE USING THESE PRIMERS.  Please note that some of these primers are currently unpublished.  You are welcome to use these primers in your own research.  However, we ask that you cite this web page and acknowledge our NSF grant 0317144 which supported this work.  Please contact Lee at fflt@uaf.edu if you have questions or would like further information.

Basidiomycete ITS Primers:

ITS1-OF-C*            AACTCGGCCATTTAGAGGAAGT  =>

ITS1-OF-T*            AACTTGGTCATTTAGAGGAAGT  => combine to form ITS1-OF

ITS4-OF                  GTTACTAGGGGAATCCTTGTT

Purpose: 

The majority of orchid species appear to associate with Rhizoctonia species which fall into the rather distantly related genera Sebacina, Tulasnella, Thanatephorus and Ceratobasidium.  However, some orchids associate with even more distant genera such as Russula and Thelephora.  However, with one exception (Epipactis helleborine and Tuber spp.), all well documented orchid associates belong to the Basidiomycota.  A very effective primer pair for the amplification of the ITS region from essentially all Eumycota, ITS1F with ITS4, has been developed which minimizes the amplification of plant sequences (Gardes and Bruns 1993).  However, the nuclear ribosomal operon of the Tulasnellaceae is evolving exceedingly rapidly (see Taylor et al. 2002 and http://tolweb.org/Hymenomycetes), and hence many primer sites which are generally conserved across the Eumycota are not conserved in the Tulasnellaceae.  The primer ITS-1F does not effectively amplify core species within the Tulasnellaceae (e.g. Tulasnella calospora, one of the most widespread orchid symbionts).  Hence, we sought to design a pair of ITS primers that would amplify Tulasnella species as well as all other Basidiomycota, while selecting against amplification of orchid genomic regions.  The goal is to be able to characterize the diversity of fungi in orchid mycorrhizae with as little bias as possible (i.e. without excluding any potential Basidiomycete associates). 

The ITS1-OF/ITS4-OF primer pair listed above fulfills these objectives.  However, amplification of plant sequences can occur with these primers at suboptimal temperatures, and optimization of the annealing temperature for individual lab conditions (thermal-cyclers and PCR reagents) may be necessary.

*  Note that the two versions of the primer (one with an C and a C, one with a T and a T), must be synthesized separately, then mixed, to create the working ITS1-OF primer.  If degenerate primers are synthesized with both bases in the two variable positions (i.e. producing C-T and T-C forms), serious primer-dimer artifacts are likely. 

Tulasnella Primers:

Family-level:

ITS4-Tul            CCGCCAGATTCACACATTGA

Combinations and Purpose:

As opposed to the primer pair described above, this is a Tulasnellaceae-selective primer.  It will NOT amplify most Basidiomycetes, nor plants.  This primer best fits core Tulasnella species such as T. calospora.  It is not guaranteed to amplify more distant Tulasnellaceae, such as Clade snLT1 identified with many Cypripedium species by Shefferson (Shefferson et al. 2005).  This is a useful primer for screening for the presence of core Tulasnella species in environmental samples such as soil or mycorrhizal roots (e.g. see Bidartondo et al. 2003), or in work with orchids already known to associate specifically with these fungi.

ITS4-Tul binds near the 5’ end of the nuclear large subunit, and points toward the small subunit.  It works well when paired with ITS1 (5’-TCCGTAGGTGAACCTGCGG-3’) or ITS1F (5’-CTTGGTCATTTAGAGGAAGTAA-3’).  However, ITS1 is a better choice, since ITS1F does not work for many core Tulasnella species.

Tulasnella species-specific microsatellites:

Goodyera pubescens Tulasnella clade:

Locus            Exp Size            Forward                       Reverse

2778_5            299             GTACCTTGATCACCGCAAGTA     ACTTTATACTTGGCGTAGTGCT

Unmatched1 348, 388        CTGTTGCACATCGACCTCAG      AGCYAACTCTGTACCCGCT

GIS-C12            221           GTTTCCTGTCCACGAGAGC       TGTCGTCGTAGTGGTGATTG

Liparis lilifolia Tulasnella clade:

Fucose            369, 389            AAACGACTAGATTTCGGACTATT      TTGTAGGCATGTCGTGAGTATGG

DictyoH1            180, 207            ATACAAGTAAATAACTTTGGACG      GTCACATAATGCACCCCA

GIS-C2            216            GCGTTATTGTACTGGCAAGTC      CACCAATGGTCAAACCACTAC

Both Tulasnella Clades:

GIS-B159            218            TTGACTTTCGACAATATCAGAG      AGGGCTGTGAGAGAGTTATC

Xylanase            338, 382            AGTGAGGGCACCGAAATCGT      CTTGAATACTTTGTACTTGGCATAGTG

These are microsatellite primers which amplify polymorphic loci from a narrow Tulasnella clade (perhaps a single species?). The ballpark expected allele sizes are given. They could be used on 1) pure isolates, 2) DNAs extracted from orchid mycorrhizae, or 3) soil samples. We are currently using them for isolates and soils. These loci can be used to identify individuals, i.e. document the occurrence and spatial extent of fungal clones. They could also be used to address other population genetics questions about these fungi.

Thelephoraceae ITS Primers:

LSU-Tom1:     TCAAGCGTTTCCCTTTCAG

LSU-Tom2:      AACTCGACTCTTTGAGAGCG

LSU-Tom3:      GGTAGTCCRTGTCAAAGACG

SSU1318-Tom     CGATAACGAACGAGACCTTAT

Combinations and Purpose:

Some myco-heterotrophic orchids, including Cephalanthera austinae (Taylor and Bruns 1997) and Corallorhiza trifida (McKendrick et al. 2000), associate specifically with ectomycorrhizal fungi in the Thelephoraceae.  We have designed these Thelephoraceae-selective ITS primer pairs in order to rapidly screen ectomycorrhizal root tips and soil samples for fungi in the Thelephoraceae.  Once amplified, species level diagnosis can be attempted through ITS-RFLP analysis or, preferably, cloning and sequencing.

SSU1318-Tom aligns about 490 bp from the 3’ end of the nuclear small subunit gene.  It has two base positions at the 3’ end which are conserved in the few available sequences from the Thelephoraceae and also differ from most other Basidiomycetes.  Any of the three LSU primers can be paired with SSU1318-Tom, or with ITS1F, to amplify the ITS region from fungi in the Thelephoraceae.  The LSU primers are similar to the SSU primer in that they have one to several bases which appear to be synapomorphic for the Thelephoraceae.  However, our empirical experience suggests that most combinations can amplify other fungal groups, such as the Russulaceae, and may have biases toward different groups.  For work with soil, we currently recommend SSU1318-Tom with the universal primer ITS4 (5’-TCCTCCGCTTATTGATATGC-3’) (White et al. 1990).

Tipularia-Fungus Primers:

ITS2-Tip14R              TGCATTTCGAGACGAGCCG

Combinations and Purpose:  

We have found that protocorms of the crane-fly orchid, Tipularia discolor, have a very specific clade of fungal associates (McCormick et al. 2004).  They are not Rhizoctonia species, and appear to be an obscure group within the Auriculariales.  However, their phylogenetic placement is not yet certain. 

The primer 14R binds in a moderately conserved region of ITS 2.  The best forward primer to use is ITS 1F (5’-CTTGGTCATTTAGAGGAAGTAA-3’).

References Cited:

Bidartondo, M. I., T. D. Bruns, M. Weiss, C. Sergio, and D. J. Read. 2003. Specialized cheating of the ectomycorrhizal symbiosis by an epiparasitic liverwort. Proc. R. Soc. Lond. B 270:835-842.

Gardes, M., and T. D. Bruns. 1993. ITS primers with enhanced specificity for basidiomycetes:  application to the identification of mycorrhizae and rusts. Mol. Ecol. 2:113-118.

McCormick, M. K., D. F. Whigham, and J. O'Neill. 2004. Mycorrhizal diversity in photosynthetic terrestrial orchids. New Phytologist 163:425-438.

McKendrick, S. L., J. R. Leake, D. L. Taylor, and D. J. Read. 2000. Symbiotic germination and development of myco-heterotrophic plants in nature: Ontogeny of Corallorhiza trifida and characterization of its mycorrhizal fungi. New Phytologist 145:523-537.

Shefferson, R. P., M. Weiss, T. Kull, and D. L. Taylors. 2005. High specificity generally characterizes mycorrhizal association in rare lady's slipper orchids, genus Cypripedium. Molecular Ecology 14:613-626.

Taylor, D. L., and T. D. Bruns. 1997. Independent, specialized invasions of ectomycorrhizal mutualism by two nonphotosynthetic orchids. Proceedings of the National Academy of Sciences of the United States of America 94:4510-4515.

Taylor, D. L., T. D. Bruns, J. R. Leake, and D. J. Read. 2002. Mycorrhizal specificity and function in myco-heterotrophic plants. Pages 375-414 in M. G. A. van der Heijden and I. R. Sanders, editors. The Ecology of Mycorrhizas. Springer-Verlag, Berlin.

White, T. J., T. Bruns, S. Lee, and J. Taylor. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. Pages 315-322 in M. A. Innis, D. H. Gelfand, J. J. Sninsky, and T. J. White, editors. PCR Protocols:  A Guide to Methods and Applications. Academic Press, Inc., San Diego.

Institute of Arctic Biology Department of Biology and Wildlife EPSCoR University of Alaska Fairbanks